HIP-DB

accession_number: 
AY604415
codename: 
HAIICrpPhPhOrOrOrt
description: 
Orthizema hadrocerum voucher NL615 28S ribosomal RNA gene, partial sequence. (Endopterygota, Hymenoptera, Apocrita, Ichneumonoidea, Ichneumonidae, Cryptinae, Phygadeuontini, Phygadeuontina, Orthizema)
gene_name: 
28S
sequence: 
CCTGAGAAACCCGAAAGTTCGAATGGGGAGATTCAATACCAGCGATTTTGGTACTTGTGCGGTTCGCGATGCCGGAGACCTCGGTCTCATGGCACGCGTCCGCATGTTTTTTATTGCCTAAATCGTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGTTGGGTGTCGGTCTACGACCCGGGCGGTAGCCTGTCTCGTGTGCGCTTCATCGCGTTACGCGGGGCAGACCCCTGTGTGTCTGGCCGGCTGCCCGGCGGTACTCGCACGGTATCTGGCCGCAAATATTCGAACTGCGTCCGGCCCGTCGCAAGCGAGGCAAGTGTTTCCCGGCTGTACGGATCTAATGCCGTCACCGGGCCTTGCCAGCTGTTGGTTGACGGTGTCCTAGGACAGGCCAATAAAATTATGATACCGGTCGGCGACGCTACTGCTTTGGGTACTTTCAGGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCATTGGGAACTAATAAGCCTAAAGGCGCAATGAAAGTGAAGGTCGGCCTTGCGTCGACCGAGGGAGGATGGGCCGCGTCACGATGCGGTCCCGCACTCCCGGGGCGTCTCGTTCTCATTGCGAGAAGAGGCGCACCCAGAGCGTACACGTTTGGAACCGAA
species_name: 
Orthizema hadrocerum
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith